PI-SceI
NEBU recombinant dil_B 37 65 Heat ralbumin

The large size of this product was discontinued on 12/31/2020. The small size will continue to be available.

We are excited to announce that all reaction buffers are now BSA-free. NEB began switching our BSA-containing reaction buffers in April 2021 to buffers containing Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes. Find more details at www.neb.com/BSA-free.

NEB restriction endonuclease that recognizes the sequence ATCTATGTCGG_GTGC^GGAGAAAGAGGTAAT
  • This is a homing endonuclease and requires 3 hour incubation periods
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: ATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGG (-22/-26)
Special Offer for Q4 Ladders
Catalog # Concentration Size List Price Your Price Quantity
R0696S 5,000 units/ml 250 units $80.00
Please enter a quantity for at least one size
Loading Spinner